Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Introduction br Prostate cancer

    2020-08-28


    1. Introduction
    Prostate cancer (PCa) is the second most common cancer and the fifth leading cause of death in men. In the United States, there are es-timated 174,650 new cases and 31,620 deaths occur in 2019. To give these numbers context, there is about 1 man in 5 will be diagnosed with PCa during his lifetime. PCa represents 20% of new cancer cases and 10% of cancer-related deaths in men (Siegel et al., 2019). In China, the trend of PCa will rise with the aging of the population and become more common than stomach cancer by 2030 (Tsoi et al., 2017). However, current treatments, including chemotherapy and radiotherapy possess limited effects on androgen-independent prostate cancer (AIPC). Therefore, researches showing the underlying mechanisms of AIPC development and the development of therapeutic reagents for AIPC are warranted.
    p53, a transcriptional factor, is widely recognized as a tumor sup-pressor, which could protect normal cell growth, initiate malignant cell death (Park et al., 2000; Han et al., 2016). Under suffer stresses con-ditions, cells occur apoptosis or growth arrest by activated p53. (Junttila et al., 2009; Ko et al., 1996; Levine, 1997). The increased P53 can inhibit the proliferation of cancer cell by altering the expression of important proteins in the apoptotic pathway, including caspases, Bax and Bcl-2 (Jiang et al., 2017). The p53-induced apoptosis is mediated by the mitochondrial pathway and by the death receptor pathway
    ∗ Corresponding author. E-mail address: [email protected] (J. Zhou). 
    The antibacterial peptide of buforin I is a 39 amino CCK-8 peptide found in stomach extracts of an Asian toad Bufo bufo gargarizans. While buforin II (a 21 amino acid peptide: TRSSRAGLQFPVGRVHRLLRK) has a stronger antibacterial activity than buforin I. One derivative of bu-forin II, buforin IIb, that contains a proline hinge between the two α-helices and a model α-helical sequence at the C-terminus (3 × RLLR), was obtained from a structure-activity study with buforin II (Jang et al., 2015). Buforin IIb (21 residues, RAGLQFPVG(RLLR)3), is an effective molecule of CCK-8 innate immunity and displays selective cytotoxicity against most cancer cell lines (Lee et al., 2008). However, whether buforin IIb exhibits an effect on PCa cell proliferation remains unclear. In the present study, we examined the antiproliferative effects of buforin IIb on human androgen-independent prostate cancer cell lines. The results demonstrated that buforin IIb showed an inhibition effect on the pro-liferation of PC-3 and Du-145 in a dose-dependent manner. Next, we also found buforin IIb could induce apoptosis in AIPC cells, which was associated with an accumulation of p53, Bax and a decrease of Bcl-2.
    2. Materials and methods
    2.1. Reagents and siRNAs
    Buforin IIb were synthesized using solid-phase methodology at GL
    Table 1
    Primers for qRT-PCR.
    p53 TCAACAAGATGTTTTGCCAACTG ATGTGCTGTGACTGCTTGTAGATG p21 CTGGAAGACTCTCAGGGTCGAA GGCGTTTGGAGTGGTAGAAATC puma GACCTCAACGCACAGTACGAG AGGAGTCCCATGATGAGATTGT fas AGCTTGGTCTAGAGTGAAAA GAGGCAGAATCATGAGATAT dr5 TGGTTCCAGCAAATGAAGGTG CCGCTGCCTCAGCTTTAGC bcl-2 TTGAGTTCGGTGGG GTCAT GACTTCACTTGTGGCCCAG bax GG CAGCTGACATGTTTTCTGAC CACCCAACCACCCTGGTCTT β-actin AATGTCGCGGAGGACTTTGAT AGGATGGCAAGG GACTTCCTG
    Biochemistry Corporation (Shanghai, China). Purification by pre-parative RP-HPLC gave final products deemed > 95% pure. 4% paraf-ormaldehyde solution, annexin V-FITC Apoptosis Assay Kit (C1063), RIPA lysis buffer (p0013B) were purchased from Beyotime Company. The antibodies for caspase-9, caspase-8, caspase-3 and PARP were ob-tained from Beyotime Company. Antibodies for Bax and Bcl-2 were from Cell Signaling Technology and P53 antibody was from Santa Cruz. The second antibodies and β-actin antibody were acquired from CWBIO company. The sequences of p53 siRNA: #1: 5′- GGUUCACUGAAGACC
    CAGTT-3′, #2: 5′-CCACCAUCCACUACAACUATT-3′ and #3: 5′- GACU CCAGUGGUAAUCUACTT-3′, while the sequence of control siRNA was 5′-UUCUCCGAACGUGUCACGUTT-3′.
    Human prostate cancer cell line (PC-3 and Du-145), Human normal prostate cell line (RWPE) and human renal epithelial cell line (293T) were acquired from the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. PC-3, Du-145 and RWPE were cultured in RPMI 1640 medium (Gibco). 293T was cultured in RPMI 1640 medium (Gibco). All these medium were supplemented with 10% fetal bovine serum, 100 units/mL of penicillin and streptomycin, which were incubated at 37 °C with 5% CO2.
    2.3. Cell proliferation assay
    Cells (1 × 104/well) were plated in 24-well plate and then treated with various doses of buforin IIb, using ddH2O as the control. Cells were gently trypsinized and staining with trypan blue dye. The viable cells were counted using a cell counting chamber every 24 h for 7 days.